circad | circRNAs associated with diseases

hsa_circ_0002711
Gene		Organism	Human
Genome Locus	chr21:16363522-16415895:-	Build	hg19
Disease	Ovarian Cancer	ICD-10	Other and unspecified female genital organs (D07.3)
DBLink		PMID	31589961
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Serum (4ml per person) from 3 epithelial ovarian cancer patients who had not received cancer therapy and 3 healthy control women
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTTGCCAAAGTTAGCCAAGG Reverse ACCATGGGGTTGAGATTCTG	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Wang, J, Wu, A, Yang, B, Zhu, X, Teng, Y, Ai, Z (2020). Profiling and bioinformatics analyses reveal differential circular RNA expression in ovarian cancer. Gene, 724:144150.